Hybridoma Sequencing Pitfalls: 3 Top Lessons Learned

The hybridoma generation process.

Attribution: Adenosine CC BY-SA 3.0 via Wikimedia Commons

Hybridoma Sequencing Pitfall #1: Aberrant Myeloma Light Chains

Many myeloma partner cells have a confusing contribution to the hybridoma: an aberrant light chain. To prevent hybridomas from producing multiple antibodies, modern myeloma cell lines are engineered to eliminate functional antibody expression. However, commonly used cell lines such as SP2/0 still express an aberrant light chain transcript. Myeloma light chains are expressed alongside the desired light chains from the fusion partner, effectively infiltrating antibody transcription. The myeloma light chain will persist through library preparation and ultimately contribute to the final sequencing library (See Bradbury et al for an analysis of the pervasiveness of this issue). Although it is easy to determine the myeloma light chain in the data, it causes problems by consuming read space and possibly outcompeting the true light chain during amplification. The resulting data becomes dominated by the myeloma light chain, which could falsely label hybridoma samples as failed.

Our solution? Specialized primers designed to deplete the sample of the myeloma light chain. During amplification, a depletion primer is added to the reaction mixture in order to inhibit the amplification of the myeloma light chain. This ensures preferential amplification of the true light chain.

>SP2/0 IgK variable region nucleotide sequence
GACATTGTGCTGACACAGTCTCCTGCTTCCTTAGCTGTATCTCTGGGGCAGAGGGCCACCATCTCATACAGGGCCAGCAAAAGTGTCAGTACATCTGGCTATAGTTATATGCACTGGAACCAACAGAAACCAGGACAGCCACCCAGACTCCTCATCTATCTTGTATCCAACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCACCCTCAACATCCATCCTGTGGAGGAGGAGGATGCTGCAACCTATTACTGTCAGCACATTAGGGAGCTTACACGTTCGGAGGGGGGACCAAGCTGGAAAT

>SP2/0 IgK variable region amino acid sequence
DIVLTQSPASLAVSLGQRATISYRASKSVSTSGYSYMHWNQQKPGQPPRLLIYLVSNLESGVPARFSGSGSGTDFTLNIHPVEEEDAATYYCQHIRELTRSEGGPSWK

The nucleotide and amino acid sequences for the aberrant light chain expressed by SP2/0 myeloma cells.  The sequence contains an edit in the CDR3 that causes the J gene to be translated in the incorrect frame and ultimately stop translation early.

Hybridoma Sequencing Pitfall #2: Barcode Hopping

Barcode hopping, also called index hopping when it happens on the sequencer, occurs when the incorrect barcode becomes associated with a hybridoma sample. While index hopping occurs when libraries are multiplexed in a sequencing run, barcode hopping can occur when samples are pooled earlier in the process. This happens PCR amplification of pooled hybridoma samples. Primers containing barcodes for one sample anneal to templates from another sample due to the high homology of templates. Poor barcode design such as combinatorial barcodes that re-use the same partial barcode for multiple samples (e.g. a row barcode and a column barcode on a plate) can exacerbate this issue.  Barcode hopping results in sequences from one sample being assigned to another sample.  This problem becomes particularly insidious when some samples do not amplify well.

There are a variety of variables that influence this problem, such as overamplification resulting in depleted primers in the sample or incomplete template accumulation. The resulting conditions allow for incorrect annealing of templates and primers.

The best way to circumvent the issue of barcode hopping is to minimize PCR cycles and utilize dual unique barcodes. Unlike a combinatorial approach, dual unique barcodes have a unique label in the forward and reverse priming direction. In this case, in order to have any PCR artifacts, a template would have to experience barcode hopping twice- which is highly unlikely.

Hybridoma Sequencing Pitfall #3: RNA Quality

Hybridomas, like other live cells, are highly vulnerable to degradation when not stored in proper conditions. When the integrity of the hybridoma is compromised, the RNA is vulnerable to degradation which makes sequencing hybridomas with NGS more challenging.  We recommend storing and shipping cells in RNA-preserving buffers such as RNAlater, DNA/RNA Shield, or similar products.

Because hybridomas usually contain a high transcript count of only one or a few different antibody sequences, it is possible to sequence a hybridoma with poor RNA quality. As long as enough transcripts remain intact, we can usually sequence the hybridoma.

While most hybridomas produce a large number of antibody transcripts, occasionally hybridomas have low transcript levels, despite having reasonable protein production. Hybridomas will produce antibody protein that accumulates in the supernatant and will show strong signal in binding assays. However, by the time the cells are preserved for sequencing, the transcription level has dropped. This can become a challenge for sequencing since there are not enough transcripts for efficient V(D)J amplification. In this instance, you can sequence the antibody protein directly using Valens.

RNA gel across 4 samples with increasing RNA degradation.  We described the impact of RNA degradation on bulk B cell repertoires in a previous blog post.

Conclusion

After sequencing 11,000 hybridomas we’ve seen it all.  We have established workflows and optimized them over years to address the common pitfalls of hybridoma sequencing.  The results are reliable, high-confidence antibody sequences that preserve the value of your assays for future research and development.

Need more information? We're here to answer any questions you have.